+Marker Data: est_per04d19

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SNP
Map Position 97.4
Annotation
Source Name PER04D19
Source Type 16k_SmUnigene
Source Sequence
Developer NIVTS
Document

Typing_Method Tm-Shift
Marker_Class EST-misc
STS_primer_fwd CTTGCTTGGAAGGATCGTTATTGG
STS_primer_rev CACGAATCTCCAGGTTTCTCATCA
amplicon_seq GCATCTGCATATGACACATGCAGGAATCAGACTCAGTTTGGAAAAAATTATCATGGAGAAAAAAGATAAATATAAGTGATTCTAAAAAAAGACAAGAAAAATCCGTTTTTGTTGCCATGGCTTGTGAAAATGGGTTGTCCTTGATTTATGATATCTGAGCTTGCTCATAAGCATTGCTAATAGACAAAGTTGCTAAAATTGGCACACAGATTAATTGGCTAGAAGTTTGTAATGACCTCCTGATGAAACTCCTATTGTGGATTCTTTAGTTGACTAGAGTGGCATAGACAAGAAGTTTCCTTGTTACACATGTCGTTAATTTGACGATCCTTTCTTTAAGAATACTTGTTGGTGCTTGTCTGGACTGACTATTGATTTGCTACTATTCCAGGCTAATCTCTGGATAGCGATTTTCACTTATGTTGGGAATTACTTTTGGACCCACTATTTCTTTACAGTTTTGGGGGCTTCGTATACATTTCCATCTTGGAGGATGAATAATGTAAGCCATCTGTTAATTTTTTTCATTCGACTCCGTCCTTTACTTGGAATTTTCATTTTACCACAAAAGGTAGGGGTAAGGTCTGCTACACCCACTCTCCCTAGACCCCACTTGTGGGATTATACCGGGTACGTTGTTGTTGTATTGGCAAAAGCTATATAATGCGACTTTCTGCAGTACCCCACACAACTTTTCTTCTAGCACATGTTTGCTTCCTGTTTTATCATGTCTCAGCAAACATGACCCTTC
SNP_position 631
allele_1 G
allele_2 T
ASP_primer_S GCGGGCGCTTTTGCCAATACAACAACAACGTAA
ASP_primer_L GCGGGCAGGGCGGCGCTTTTGCCAATACAACAACAACGGAC
Common_primer AGGTCTGCTACACCCACTCTCCCTAGA
enzyme Native Taq
dye SYBR Green I

Line allele-1 allele-2
AE-P03 T T
LS1934 G G
WCGR112-8 T T

Population Linkage Group Position
AL2010 E_05 97.4
ALF2 AL05 129.0
LW2010 E_05 96.1
LWA2010 LWA_05 93.431
LWAE2012 E_05 92.505
NAF2 NA05.2 0.0

DB Program Definition E-Value

EST Name Species Strain