+Marker Data: est_ae505n08

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SNP
Map Position 17.5
Annotation
Source Name AE505N08
Source Type 16k_SmUnigene
Source Sequence
Developer NIVTS
Document

Typing_Method Tm-Shift
Marker_Class EST-misc
STS_primer_fwd tattgctcatcatggtgaaggtcg
STS_primer_rev cggctaacctaggcatccaaagat
amplicon_seq CNNNNNTACTGAAATTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAATAAGGTTCATTCAAATATTTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGAATTATGTTTATTTTCTTTGTTCTAACAAATATTTCTTTTCCTTTTTCTTTGTATAAACTAATTTCTTCATGTAGATAAATATTCATATGAGTATGTTTGTTGTATGATTACTTTCCGTACAAGGTAATTTCTTAAATGCTAAGTACTTGTCCAATCTGATGACATAAAGGGGGAAAAAAAGTTTTTTGGGGTGGGGGGTGGGGGTAAAAGTATTGTAATATTAAAGTAGTATCTGTATATTTCACATTGATCGATTTTTTCTTATTGAAAATAGAATATTTC
SNP_position 395
allele_1 T
allele_2 C
ASP_primer_S GCGGGCGAAATATTCTATTTTCAA
ASP_primer_L GCGGGCAGGGCGGCGAAATATTCTATTTTNAG
Common_primer TCTGTATATTTCACATTGATCGATTTTT
enzyme
dye

Line allele-1 allele-2
AE-P03 T T
LS1934 C C
Nakate Shinkuro T T
WCGR112-8 T T

Population Linkage Group Position
AL2010 E_05 17.5
ALF2 AL05 18.0
LW2010 E_05 23.0
LWA2010 LWA_05 21.164
LWAE2012 E_05 22.68

DB Program Definition E-Value

EST Name Species Strain