+Marker Data: SOL7367

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SNP
Map Position 9.9
Annotation
Source Name AE505D07F
Source Type 16k_SmUnigene
Source Sequence
Developer NIVTS
Document

Typing_Method Tm-Shift
Marker_Class SOL
STS_primer_fwd CAAGCTGGAGCGGTATATGTCAAA
STS_primer_rev GCACTCACGAGTCCCTGAAAATGT
amplicon_seq NNNNNNNAAGTTTTCTATCCTCTCGAATGACTTGCCTATATCTGAGATCAATATATCAACTTCATAAATAGGTAGTAAAATGGTTATGAATCCACGATGACGAAAGATAATTGATGCGTCCGACTTAATCTTAGGTCAAATTTAAATGTTGATCAGTGAAGACAAGAAAGCTTTTAGGTGTAGATGACTACTTGTACTTGAAATTCCATTCCTTTATCCAGTGGGAGGTTTAGAACCAGTTAAGCCAATATTATATTTAGCAAAGCTTCAGCAACACTAGCTACATCAGTAGATTATCTATTAGCTTACCTCCTCTGAATAGTCTATGTGGACCCTAATTTCTACTATTATTAATTCAAATTAATTAAGTAATGCATCCGCGCACTGGGAAAAGGCTGATGCAACAGGAAGCTGATTACTGGTTACAAAGCATGCCTTTCCCTTTCATTTTTCCTACAAACTTAAATTCTTTAACTATTTTTTCATATCTTCTCAGTTGGATAGCAAACATGAGGCTGGTAGTGCTTACGCTAATGCTGCTCATTGCTACAAGAAGACAAATATAAGAGGTTGTATGTTGCCTTCTTGTACTTCTTTCCACTTCTTTTATGTTAAGGAATGTCTTATGTGCTCCAAAATAATGTGTTGTTGACATCCTTGGATATGTCCATTGTGCAGTAGATTGAAGCTCTTCTAGATTTCTTTCAGTACGAACTCTTTAAAAGATATGTTGTACAATTTAGTAATGAACAAAGGCTACTTGTCCATTATGGTCTATGAGTGGTCGTTCGTATCGTTGTTGGTTGTGCTGCTCCCCTATTTATATATAGTTTCTCTATTGTCCTTAGCAGCTGGGCAACCTCCTCTTTATGGGTGAGCTTATGGCAATTGCTAAAAACATGATACTAGCAGTATTTGAATGCTTCCCGTAANGATGTTGAAAGANTGCATTGTCCCACTGTTCGGGAGTATTGCTGAGCACTCCCGCCTGTGTAGACCTCTTGATAAATGACTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATACATAATAAATCTGCTGTTTGCAGGAAATTGCTGAATTATATGAACAAGAGCAAAATTTGAAGCAGGCTATCATTTACTATGAGAAAGCTGCTGATCTTTTCCAGAGTGAGGATGTAACATCATCTGCAAATCAGTGCAAGCTGAAAATTGCTCAATTTTCTGCTCAAGTAGAACAGTAAGATTCTTGTCTTGAAGTAGTAATACAGTTTCCTAAAAGATTCTTGTCTTGAAGTCATAGTACAGTTNCCTAAGGAAGAATAAATGTGTCTGGCAATTGCAAAGTCATTGCTGAGCTTGGAAATGTTGACACAGTTGAAGACAAAGGCAACTGGTTAAAAAATGGACCTAAAAGCTGCAAGTGAAGTTCCTTTGAGAACAATTTCTGCATAGTCTGGGGATCTGAATTTGAAGCTAAGCTTCCCTGTTTATCTTGTGTGGAAGTATGGAATTCTATCCTAGTGTCTTAGAGTACTAATGCAATAAATCTTATATATGGGTTGAGAAAAGGAAAGATATAGGAGTCAAAACTAACTACTAGGAAAAGAAATCAGTTCCAAACTAAGTATAGAAATGTGTATTAAATGCTCATTTTAAAAGCACCGACAATTTATAAGTTATAAATGTTAATAAGCTAATGCTTAACTTGTAACTGCTCCATATATAAGAAACTAAGAATTACTGAAGTTTTGCATTGTAAAAGAAAACTTAACGTCCAGAATTTGTCACACAGATATCAAAGAGCAATTGAGATCTTTGAGGAGATAGCCCGGCATTCCCTCAGCAACAACTTATTGAAATATGGAGTTAGAGGGCATCTTCTGAATGCTGGTATTTGCCAACTTTGTAAAGGTGATGTTGTTGCAATCAACAACGCATTGGAGCAATATCAGGTAGAGTATTCTTCTTGTTAAGCCTCTAAGATTTCAACTGACATGATATGTCTAAGTAAATAATGANTCCTAACTGNN
SNP_position 1328
allele_1 T
allele_2 G
ASP_primer_S GCGGGCAAGTAGTAATACAGTTTCCTAAAAGAT
ASP_primer_L GCGGGCAGGGCGGCAAGTAGTAATACAGTTTCCTAAAATAG
Common_primer TTGCCAGACACATTTATTCTTCCTTAG
enzyme Native Taq
dye SYBR Green I

Line allele-1 allele-2
AE-P03 G G
LS1934 T T
Nakate Shinkuro G G
WCGR112-8 G G

Population Linkage Group Position
AL2010 E_05 9.9
ALF2 AL05 9.7
LW2010 E_05 13.0
LWA2010 LWA_05 12.8
LWAE2012 E_05 13.255

DB Program Definition E-Value

EST Name Species Strain