+Marker Data: SOL4134

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SNP
Map Position 87.2
Annotation
Source Name YFR01M23A
Source Type 16k_SmUnigene
Source Sequence
Developer NIVTS
Document

Typing_Method Tm-Shift
Marker_Class SOL
STS_primer_fwd ATTCCTGATGAATTGGTGGAGCAT
STS_primer_rev CAGCAGATGGGCTATCAGCAAAGT
amplicon_seq CAGGAAGAAGTGGATTCAATGTCCTGACGTTCGATTGTATGTACCCTATTCCCATTCTCGTGTTGATGTTTCTGCAATTCAGCCTGCTTAGATTAGTTATAGAAAAATTGTCTGGATTGTTCAAGAGGAAGAGAATTAAACTATTATTGTATGATTTTCTTAGGTTTTTCCCCTTCTTTTATACTGACAATCCTTCTTCAGCTAATCCACATTCTTCGAAACTGAGATTCTCCCCTTAAATGCTAGGCTTAGTTCACTTGGTGTAGGGCTCGAACTTATGAAGCCTCAAATCTCTCAACCTTTATCTAAGTGAGCTAAGCTCCTGGGGTCAAAGGGAGATATTAGTATATTACTGCAGAAAACGAATAAATTGAGCAATGGTGTCCATATCACACTGTGTAATCCAGCTTGGAAAGAAGTGCTTCTGAGATATCTCCTTCAATGAAGTACTAGAAAATTTAAGCTAAATTATGTGCTAGTTTTGTTTAGACTTCTAGGAATATAAACAAAGTCTACATGATCAAGGAAAACCGATAGCTTTAAGTGTCCCATGAGGTAGTAATTTTTTTTTTGAATCATATCAATAACACTCTTTGCATCGAATAGAATCTTCACATCCTTTCATCCATTCCTGACTGCACGTTCAAGAGCCATTCTTTTAGCAAGCAGTTCGACAGTCATACCTTTCCCACAAACTGGGATTGGGGAACCATGAGAATGAATCAGTT
SNP_position 235
allele_1 C
allele_2 A
ASP_primer_S GCGGGCACATTCTTCGAAACTGAGATTCTCCCA
ASP_primer_L GCGGGCAGGGCGGCACATTCTTCGAAACTGAGATTCTCCCC
Common_primer GCTTCATAAGTTCGAGCCCTACACCAA
enzyme Stoffel frag.
dye EvaGreen

Line allele-1 allele-2
AE-P03 A A
LS1934 C C
WCGR112-8 A A

Population Linkage Group Position
AL2010 E_05 87.2
LW2010 E_05 89.1
LWA2010 LWA_05 85.838
LWAE2012 E_05 84.64

DB Program Definition E-Value

EST Name Species Strain