+Marker Data: SOL4062

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SNP
Map Position 91.0
Annotation
Source Name SmFL24H05A
Source Type 16k_SmUnigene
Source Sequence
Developer NIVTS
Document

Typing_Method Tm-Shift
Marker_Class SOL
STS_primer_fwd CAGATGGAAGCAATGTGGTAGCTG
STS_primer_rev AGAAGCTCTCGTCGTCTTTTGGAA
amplicon_seq CCTGAATTAAATGAGCTTGAAAAAATAAACAAGCTTCCGTACCTTTTTGTGAGGCATCTCCCGCCTAAATATAGGTTATAACTGTAAATTATGCATTTTTGGATTAACCTCTAACGTTGGCCCGAGGTTAAGACCTTCAAAGACTATATTTGGGGAAAAAATTTCAAACGGAAAGCCCTCTCCGAGTGGGAAAAGAAGTGGTAGCTGCTTCAGAACCCCTAGCTGTGCTGGTAAGTTAATTCATACTTTAAGTCATTTATGTCGACCACATTAGCCTAACCCCTAGCTGTGCTGGTAAGTTCCTTCGCACACTGATTCCGTCGATTTTGTGCCCTTCCCAGGCCAAACTAACCAACATAAGCTTGTCAGGTAAACAAGGGTACTGCAAGTGCAAGTGAGATTTTAGCTGGTGCTTTGAAAGATAATAAGCGTGCGCAGGTGTTTGGTGAACCAACATATGGCAAGGGGTAACAACTTCATTACTCTTGTCCAAATATGCTATAGCTCGCAAAAGAAGAATGTTTGTAGCCTCTTCTTACTTTTCTCTTCTTCTGATACAGTAAAATCCAATCAGTATTCCAGCTATCAGATGGCTCTGGCTTGGCTGTTACAGTTGCTCGGTATGAAACTCCTGCTCACAACGATATAGACAAGGTCTTCCTCTCACTCTCGTTCTGTTGTGTAGTTGCCATGAGCAAATATGGTTGTTGATGTGTATCGTCTTTCTAGGTTGGTGTAATCCCGGACCATCCTTTGCCAGCATCATTTCCAAAAGACGAAAAAAGCTATCATAGATA
SNP_position 336
allele_1 T
allele_2 C
ASP_primer_S GCGGGCCTTATGTTGGTTAGTTTGGCCTGGGA
ASP_primer_L GCGGGCAGGGCGGCCTTATGTTGGTTAGTTTGGCCTGTGG
Common_primer GTAAGTTCCTTCGCACACTGATTCCG
enzyme Native Taq
dye SYBR Green I

Line allele-1 allele-2
AE-P03 T T
LS1934 C C
WCGR112-8 T T

Population Linkage Group Position
AL2010 E_05 91.0
ALF2 AL05 123.3
LW2010 E_05 91.6
LWA2010 LWA_05 88.737
LWAE2012 E_05 87.737

DB Program Definition E-Value

EST Name Species Strain