+Marker Data: SSR10368

Crop cucumber
Population CSRILs
Linkage Group 4
Marker Type SSR
Map Position 70.0
Annotation
Source Name
Source Type cucumber_genomic
Source Sequence
Developer
Document Ren el al. 2009

motif (AAT)20
PCR product (bp) 138
fwd primer SSR10368-F
fwd primer seq. TGTTCCGGCTCTTCAGAGAT
rev primer SSR10368-R
rev primer seq. GCCCGTATTTTATAAATAGTTTCATTT
fwd primer_for postlabel SSR10368-FA
fwd primer seq._for postlabel aTGTTCCGGCTCTTCAGAGAT
rev primer_for post label SSR10368-R
rev primer seq._for post label GCCCGTATTTTATAAATAGTTTCATTT

Line allele-1 allele-2

Population Linkage Group Position
CSRILs 4 70.0

DB Program Definition E-Value

EST Name Species Strain