+Marker Data: AX-95777888

Crop tomato
Population Axiom_SL96_v2014
Linkage Group Chr.09
Marker Type SNP
Map Position 0.208
Annotation
Source Name SL2.40ch09_22026
Source Type genomic
Source Sequence TAACACAGTTTAAGCTTTTAGATGAGATGACCACA[G/A] TACAGTTTGTTCAATGTCTCATTTGCTTCTTTATT
Developer NIVTS
Document

SNP_ID SL2.40ch09_22026
Typing_Method Axiom MyDesign TG
Chr. (SL2.40ch) SL2.40ch09
SNP_position (SL2.40ch) 22026
Heinz 1706 G
alternative allele A

Line allele-1 allele-2

Population Linkage Group Position
Axiom_SL96_v2014 Chr.09 0.208

DB Program Definition E-Value

EST Name Species Strain