+Marker Data: AX-95770450

Crop tomato
Population Axiom_SL96_v2014
Linkage Group Chr.09
Marker Type SNP
Map Position 0.166
Annotation
Source Name SL2.40ch09_19119
Source Type genomic
Source Sequence TATATTTCTTATTTAAATTGTGTTTATTTTGTTTT[A/G] CATATCTAACCTTTTGTTCATATTGATTTTCCTTT
Developer NIVTS
Document

SNP_ID SL2.40ch09_19119
Typing_Method Axiom MyDesign TG
Chr. (SL2.40ch) SL2.40ch09
SNP_position (SL2.40ch) 19119
Heinz 1706 A
alternative allele G

Line allele-1 allele-2

Population Linkage Group Position
Axiom_SL96_v2014 Chr.09 0.166

DB Program Definition E-Value

EST Name Species Strain