+Marker Data: AX-105351815

Crop tomato
Population Axiom_SL96_v2014
Linkage Group Chr.09
Marker Type SNP
Map Position 1.145
Annotation
Source Name SL2.40ch09_86887
Source Type genomic
Source Sequence ATGAAGCAAAACATATCTAGTACGGTTGCTGGCCT[T/C] CTTACTTCCCTTTTGCCTACTGACCGGGTTGTACT
Developer NIVTS
Document

SNP_ID SL2.40ch09_86887
Typing_Method Axiom MyDesign TG
Chr. (SL2.40ch) SL2.40ch09
SNP_position (SL2.40ch) 86887
Heinz 1706 T
alternative allele C

Line allele-1 allele-2

Population Linkage Group Position
Axiom_SL96_v2014 Chr.09 1.145

DB Program Definition E-Value

EST Name Species Strain