+Marker Data: est_smfl17n18

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SNP
Map Position 98.7
Annotation
Source Name SmFL17N18
Source Type 16k_SmUnigene
Source Sequence
Developer NIVTS
Document

Typing_Method dCAPS
Marker_Class EST-misc
STS_primer_fwd gaagccaaagttagaacaagaaggga
STS_primer_rev ctccgcgatcaaaggctactttc
amplicon_seq CGCAGAGGTAAACTCAAAAGTTCCAATCTTGAGCTTTTTACCAACATGGGGCAATGAAATATGCTCTTGGGGTCTTGAATTTTGAGGTTTAAGCATGAATTTGTGTTATAATGTAGCTATGTCCAATTGGGTTAATCTTGTTTGTTACTAACATGGGGCAATGAAATATGCTCTTGGGGTCTTGAATTTTAGGTTTAAGCATGAATTTGTGTTATAATGTAGCTATATCAATTGGGTTAATCTTGTTTTTTACTAACACATATGCTCTTGGGGTCTTGAATTTTGAGGTTTAAGTATGAATTTGTGTTAGAATGTAGCTATGTCAATTGGGTTAATCTTGTTTGTTACTAACATGGGGCAATGAAATATGCTCTTGGGGTCTTGAATTTTGAGGTTTAAGCATGAATTTGTGTTGTAATGTAGCTATGTCAATTGGGTTAATCTTGTTTGTTACTAACATGGGGCAATGGAATCTTTTTGTGGGGTTTTGAATTTGAAGTCTTTAGTAATGAATTTGCGGTATAATGGAGGTATTTAACTAGTAAAGGAAACAAAAAAAAGCACCTTTTTTCAATTGGGGTTATCTTTTTTGGGGGTAAGATTTGTCTTGTTTTTGCTTAAATGGAGTGACATGGTCAATGAGAATTCATATGGCTGGCTCCTACTTGCTTGGGATTGAGGTGGAGTAGTAGTTGTTGTTGTTAAGGTTAATCTTGTTTATCTGTATGTGGCAATGCAATCTTTTAAGCAGAATGAAAGTTAGTCCTATATTGACAAGGGCAAGAGGGAAACCATTTCTCCACCTAGCCCTAACTAGCCTATATATTCGAGGGAAGAGGCTGGAACGAAAAAGACnnnnnGCTGCGAGGATAGACTTAAAAGCTCAGTAAGGGAAGTGGAAAGTTATAGATATAGTTAAGATCAGAAGATTAGGATAGTGCGGATTTAAGAAGATTAGGGGAAGAGTTGTTGGGTCCTCATTATCCAGTTTTTGTATTTCCCTATAAAAGGTAAGCATATGTTATTGTTATCTTTATTTACTAGGTTGCCTGAAATCGTCGCTCGTGCTTTGAGTTCCCTGAGGCTCCATGCTTCACCTAACATTTTGGAATTGCAATCTTGATCAACTGAAGTACACCTATCCTTGTGGATGTAGCCTCACTTATCCTCATCACAGTTTATGTTTTTATATAGCTAGTGCTGAAACGTGTCAACAGCGAGCAGTTTTTGGCACCTTTGTCTTGGTTACCATTGCTTGTTCGCTCATTCATGGCAAAAGCAACAACATTTGCATTCTCTTTCAATGCATACGTGTGCTCTGTTATGTTCATGGTGGAGTTCTTTCCATCTATTAGAATCTTGTTGAAGCTATTCGATATTACTCCATAGAACATATATGAACTATCACATGGTGTGGTCAGTTGCAGCATTGAAAGGACGGAAATGATTAAATGAACTACGAAAAAGGAAACAGCAAAACAGTGCAGAGTTACCGGAGAGAACTTGTTATGCTGTTTATGAATTGTAGGCTCTGTCATAACAAGCTTTTGTTGGCAGGAAGTGGCAAAGAAAGTAGGCGA
SNP_position 1460
allele_1 C
allele_2 A
CAPS_primer_fwd GGACGGAAATGATTAAATGAAGTA
CAPS_primer_rev CTTTCTTTGCCACTTCCTGCCAAC
CAPS_enzyme AfaI(RsaI)

Line allele-1 allele-2
AE-P03 C C
LS1934 A A
Nakate Shinkuro C C
WCGR112-8 C C

Population Linkage Group Position
AL2010 E_05 98.7
LW2010 E_05 97.2
LWA2010 LWA_05 95.195
LWAE2012 E_05 94.226

DB Program Definition E-Value

EST Name Species Strain