+Marker Data: ge66-346pmA0026C

Crop pepper
Population KL-DH
Linkage Group KL11
Marker Type SSR
Map Position 76.47
Annotation
Source Name
Source Type genomic DNA
Source Sequence cctaattatagttctatttattatttatatttctctataa ttatacatcagcattcattattttgtacgttatttaatac aacctataaatgtgagtcggtttaattattttattacaca aataataaattgatcaaatcaaattctccactttttaatt tttttgacttttttgcaccaactatcccaaatttaaggga tatgttggctaaaaaaaaatttaatatctttttttatatt attgttttctcctttaatactcgACACACACCACACAatt acaccacaccttaaACACACACatacaaaaaattaaattt ccttatgcTCTCTCTCTCTCTCTCtaaaatccttctcaag tcacgccctttctcttcttTCTCTCcatcactgccgccac cggaattggtcaccgatagcctgcaaccatcaactCCACC ACCAtcaaactcccctttcTCTTCTTCTctattccctcAC CACCACCggctcgccgtaggtgacaaccgatgagtccgat atactgccatcgctacaatccattccctgccaaccagatc cgccgcaccaccaaccaccaataaaaacttcttcgttttc cttctctttctgccactgttcattgagaaattggctagat ctggccgctttttcattttttggcgttgctccggtgaata ccgttgaagaaatgcaactaacaacttttgttgtcttcga tttcatgatttatttaggcttctgctacaaggctaaaca
Developer NIVTS
Document

old source name
typing_method 13% PAGE
motif (ac)4(ca)3attacaccacaccttaa(ac)4atacaaaaaattaaatttccttatgc(tc)8
PCR product (bp) 195
fwd primer
fwd primer seq acccaaatttaagggatatgttggc
rev primer
rev primer seq gtttaagaagagaaagggcgtgacttga
PCR condition 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C
polymerase Native Taq
comments QV: estimated by sequencer

Line allele-1 allele-2
K9-11 193.7 193.7
MZC-180 (selfed LS2341) 180.9 180.9

Population Linkage Group Position
KL-DH KL11 76.47

DB Program Definition E-Value

EST Name Species Strain