+Marker Data: ge26-90pmH0045C

Crop pepper
Population KL-DH
Linkage Group KL05
Marker Type SSR
Map Position 75.32
Annotation
Source Name
Source Type genomic DNA
Source Sequence tgtttagccttgtagcagaagcccaaattgaactttattt atccacatacgaagggaaaaaaacctataacccaacaatt ctttccattgcaactatatgaaggagacttccatttcaat aatcttgcaacaattttcaaactttccacttggcaaagat tttgtcacaacccgaactagggtctggccgtgatgggtat ctcgagtccaccgaggactggcgaccacccccttagccta tccaatcggaacaaaACACACACACACACACACACACACA CACACACACACACaTATATATATATATATATAgGAGAGAc tagcctaacagtctaagtgatatcaatatccaaaagtatc cacgatacccatgtccacagtatccacaaagcctctacca caaattgagtatcaataaagtgacaggacatgtactagac catagccaaaataagaccgaaataaagtcttaagacataa ggactaatacataaaatgaagtgcttctgctacaaggcta aaca
Developer NIVTS
Document

old source name
typing_method 13% PAGE
motif (ac)19a(ta)9g(ga)3
PCR product (bp) 156
fwd primer
fwd primer seq acttagcctatccaatcggaacaa
rev primer
rev primer seq gtttggatactgtggacatgggtatcg
PCR condition 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C
polymerase Native Taq
comments QV: estimated by sequencer

Line allele-1 allele-2
K9-11 154.2 154.2
MZC-180 (selfed LS2341) 148.1 148.1

Population Linkage Group Position
KL-DH KL05 75.32

DB Program Definition E-Value

EST Name Species Strain