+Marker Data: ge257-93pmA0742C

Crop pepper
Population KL-DH
Linkage Group KL01
Marker Type SSR
Map Position 36.17
Annotation
Source Name
Source Type genomic DNA
Source Sequence gcctcttgtTATATAagattattagactgaactggttgtg tcaaagactcaagagaatcaaatcagaactgctccgtttt aaaagcctttacatgcgtatatgtgcataaataTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGtatatgtgcaatg tatgtcaataaaagtaagccggtaATATATcaaactgaat cgtggcgacatatacggcaacctagtctctgctttcagat tgggcttaaacagttccggacatctgacccagacaaaaga atgtcactctgaatcacatccctcttgaccatacttttta ttccattatctttggcatttaattgtacttcccatacaaa tttgacaTATATAgaggatgcctcttcatcaaaattacag tcttccgatcaaaactatgcaacttgctttgcagcaattc ataaagtgaaggttaaatcctaagttgctcggactcgggt gcgggtgtccgatacgggtacgcatctagaggtcggatcc ttcatgatttcaatttaaaaattcggggatatggatctag ggatggatatgggtgcagggattccacaaaaaataattta aatatctaaaaatagaattatagaacataaattatgagat atcacgtggaaaacttgaggagaaaatattgttcaagaag aaaatcctgaaaggagataaaaggtaaagcattaacatag aaatttcTATATATAaggtattccattttcttcgattcca ccttaggcttctgctacaaggctaaaca
Developer NIVTS
Document

old source name
typing_method 13% PAGE
motif (tg)17
PCR product (bp) 164
fwd primer
fwd primer seq atgaactgctccgttttaaaagcct
rev primer
rev primer seq gtttgactaggttgccgtatatgtcgcc
PCR condition 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C
polymerase Native Taq
comments QV: estimated by sequencer

Line allele-1 allele-2
K9-11 169.3 169.3
MZC-180 (selfed LS2341) 167.1 167.1

Population Linkage Group Position
KL-DH KL01 36.17

DB Program Definition E-Value

EST Name Species Strain