+Marker Data: ge215-246pmc0798W

Crop pepper
Population KL-DH
Linkage Group KL07
Marker Type SSR
Map Position 124.39
Annotation
Source Name
Source Type genomic DNA
Source Sequence nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgtttagcct tgtagcagaagctttcaatattggctgactactacggacg agaaattgcagcctatgatatccaaacaactcgctgtgat ctgtatggacaggttagcatttaggtagtaggatgcgtaa tcacctatttctacgtcattcatttaacaaatcccgattc ttctgaaccacatttatatgacttaatgttaaacagggaa agaactatcaggaaagagtaatgttgatttatgatggact tcattatgatgctttggctgtatggTCTCTCTCTCTCTCT CTCttTCTCTCTCTCTCTCTCTCtacacatgcaccttctt gatcattcagtttcccttcaggaggaacaagaaggaaaga ttcaattttgtgaagatttttagatcctgcgaatagttgg actttgtttggaatcttatcaaattagtgaatgaattaaa tgattagaatatgagataggattagtgatccgaatctgat attaatgatcgttaaaaaaggacagtgttcatttggtatc tgggtttttctacttcatatttatttaatatgaataggct tctgctacaaggctaaacannnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnn
Developer NIVTS
Document

old source name
typing_method 13% PAGE
motif (tc)9tt(tc)9
PCR product (bp) 200
fwd primer
fwd primer seq ataatcccgattcttctgaaccac
rev primer
rev primer seq gtttcctcctgaagggaaactgaatg
PCR condition 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C
polymerase Native Taq
comments QV: estimated by sequencer

Line allele-1 allele-2
K9-11 204.3 204.3
MZC-180 (selfed LS2341) 192.1 192.1

Population Linkage Group Position
KL-DH KL07 124.39

DB Program Definition E-Value

EST Name Species Strain