+Marker Data: es756TC3981S

Crop pepper
Population KL-DH
Linkage Group KL01
Marker Type SSR
Map Position 92.06
Annotation
Source Name TC3981
Source Type misc cDNA
Source Sequence ctcattcacctttacatctcccttcctaatccttatcccc cTCTCTCTCTCTCctttctttcccctattgatctgaagaa acaataaTCTTCTTCTTCATCATCAgataataatcagcag ttcatatttcctttttatgtcatcgttttcttctgggctc aaattggactagtgattcaatcgattcggttccaaatttg attctattttctgaatctgatggaatcaatggttatagac ataccttcaacggtgatctcgaatcctgtaatgtcctctg acagagtaataccaaggagaaaaaagagtaaaaaaagttt gagaaatcaaactcaaaacaataacagtagcaataacagc aacagcgaaactccgagtaatacaactgaatggaaaacac aagctCAACAACAAgtctactcttcaaagctactcaaagc actcggtgaagtgcgaatcagttcatcagaggctactcca tctgtgccggcgccaaaaggaggacgagccatacgcgaag ttgctgacagagtccttgctgttactgctagaggacgatc caggtggagccgagctatacttaccaacaggctcaagctc aagttcatgaagaaacatgccaagcggcagaaactagcgg cttcttgtaccagcaggctacctaggaagcctagagtggg gattttgaagct
Developer NIVTS
Document

old source name
typing_method 13% PAGE
motif (tc)6
PCR product (bp) 146
fwd primer
fwd primer seq acccttcctaatccttatccccct
rev primer
rev primer seq gtttgagcccagaagaaaacgatg
PCR condition 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C
polymerase Native Taq
comments QV: estimated by sequencer

Line allele-1 allele-2
K9-11 178.2 178.2
MZC-180 (selfed LS2341) 182.3 182.3

Population Linkage Group Position
KL-DH KL01 92.06

DB Program Definition E-Value

EST Name Species Strain