+Marker Data: es729TC6624S

Crop pepper
Population KL-DH
Linkage Group KL10
Marker Type SSR
Map Position 142.49
Annotation
Source Name TC6624
Source Type misc cDNA
Source Sequence ctgtaaaaccctaaatcaaccccaaattcaaTCTCTCTCT CtaaaaatccTCTCTCTCTCTCttcgatcccaaattgtta aaacccaaaattcgttcactttttcttcaatttttgttaa caatttgcgaagaaaagcaaggctggcgattggttttgca gtcaggtaatgggggcggatccgccATATATccgccaaat ccaacaacgaataattttcccgaatttgttgaatttttta gtagtgttgagaagaggatttggtacattttgtgtatttt gtgagttttgtgagattgaaggatgctgaGTGTGTtaagg gtacatttaccatccgatataccaattgttggatgtgaac ttacgccttatgtgcttttacgacggccgaataaggataa atcggttattactgaagatgttaatgaagcggctccagtt gatggatattttctgagatacaaatggtaccgtatacaaa gtgataaaaaagttgctatctgtagtatccatccatctga gcaagccacattacagtgccttgggTGTGTGaaggccaaa atccctgtctctaagagttaccattgctcacctaaatgct tctcagatgcctggcaacatcatcgtgttctgcatgaacg tgctgctagtgctgtgaatgaaaatggaaacgaggaggaa gaaatatttgggcgatttaatagttctggctct
Developer NIVTS
Document

old source name
typing_method 13% PAGE
motif (tc)5taaaaatcc(tc)6
PCR product (bp)
fwd primer
fwd primer seq atgtaaaaccctaaatcaacccca
rev primer
rev primer seq gtttcccattacctgactgcaaaaccaa
PCR condition 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C
polymerase Native Taq
comments

Line allele-1 allele-2

Population Linkage Group Position
KL-DH KL10 142.49

DB Program Definition E-Value

EST Name Species Strain