+Marker Data: HpmshpMADS

Crop pepper
Population KL-DH
Linkage Group KL08
Marker Type SSR
Map Position 24.03
Annotation
Source Name
Source Type
Source Sequence
Developer Seoul National Univ
Document Lee et al. (2004) Characterization and molecular genetic mapping of microsatellite loci in pepper. Theor. Appl. Genet. 108: 619-627

old source name
typing_method 13% PAGE
motif
PCR product (bp)
fwd primer
fwd primer seq tgctttcaaaacaatttgcatgg
rev primer
rev primer seq gcgtctaatgcaaaacacacattac
PCR condition 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C
polymerase Native Taq
comments QV: estimated by sequencer

Line allele-1 allele-2
K9-11 224.2 224.2
MZC-180 (selfed LS2341) 213.9 213.9

Population Linkage Group Position
KL-DH KL08 24.03
KL-DH_2024 KL08 24.03

DB Program Definition E-Value

EST Name Species Strain