Crop | pepper |
---|---|
Population | KL-DH |
Linkage Group | KL12 |
Marker Type | SSR |
Map Position | 151.01 |
Annotation | |
Source Name | |
Source Type | |
Source Sequence | |
Developer | Seoul National Univ |
Document | Lee et al. (2004) Characterization and molecular genetic mapping of microsatellite loci in pepper. Theor. Appl. Genet. 108: 619-627 |
old source name | |
---|---|
typing_method | 13% PAGE |
motif | |
PCR product (bp) | |
fwd primer | |
fwd primer seq | catgaatttcgtcttgaaggtccc |
rev primer | |
rev primer seq | aagggtgtatcgtacgcagcctta |
PCR condition | 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C |
polymerase | Native Taq |
comments |
Line | allele-1 | allele-2 |
---|
Population | Linkage Group | Position |
---|---|---|
KL-DH | KL12 | 151.01 |
KL-DH_2024 | KL12 | 151.01 |
DB | Program | Definition | E-Value |
---|
EST Name | Species | Strain |
---|