+Marker Data: CAMS-020

Crop pepper
Population KL-DH
Linkage Group KL05
Marker Type SSR
Map Position 140.3
Annotation
Source Name
Source Type
Source Sequence
Developer Kyoto Prefectural AFFTC
Document Minamiyama et al. (2006) An SSR-based linkage map of Capsicum annuum. Mol. Breed. 18: 157-169

old source name
typing_method 13% PAGE
motif
PCR product (bp)
fwd primer
fwd primer seq cagcagtaacagaggcaggtc
rev primer
rev primer seq cacaagtgagtttattcatatcacca
PCR condition 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C
polymerase Native Taq
comments

Line allele-1 allele-2
K9-11 161.6 161.6
MZC-180 (selfed LS2341) 165.3 165.3

Population Linkage Group Position
KL-DH KL05 140.3

DB Program Definition E-Value

EST Name Species Strain