+Marker Data: BRMS-062

Crop Chinese_cabbage
Population AGF2
Linkage Group 9_R10
Marker Type SSR
Map Position 51.4
Annotation
Source Name
Source Type genomic
Source Sequence
Developer NIVTS
Document Suwabe et al (2006) Simple sequence repeat-based comparative genomics between Brassica rapa and Arabidopsis thaliana: The genetic origen of clubroot resistance.Genetics.(173) 309-319

motif (GA)50
PCR product bp
fwd primer BRMS-062F
fwd primer seq. CTGCTGTGGAGATCGTTCATTGTAT
rev primer BRMS-062R
rev primer seq. CCTTTTCTTCTGGGTTTCCTGACTT
dye
PCR condition 94C_3min->(94C_30s->55C_30s->72C_30s)x30->75C_7min->10C
polymerase rTaq(Takara)

Line allele-1 allele-2
A9709
G004
Kigokoro85
Kigokoro90
Muso

Population Linkage Group Position
AGF2 9_R10 51.4

DB Program Definition E-Value

EST Name Species Strain