+Marker Data: emk04D19

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 51.6
Annotation
Source Name emk04D19
Source Type genomic
Source Sequence ACCATCGTTAGAAAAGTTACAACTCAGGAAAAATCATAAC TCTTCGAAAAAATCAGAATCCTTCGAAAAAGTCACAACTT TTCGCAAAAGTCACAATCCTTCAATGTAAAAAATTATCTG TTAGAACCCGTATTGTGGTGTTTTGGATCAATTACGAATT TTGGACCAAAGAGATATTATTGAAAATTTGGGATTTAAGT TGAATATTTCAAAGAGATGTGTTTAAACCTATATACACAC ACACACACACACACACACACACACACACACACACACGTAC ACATACAAGACCATTTATTAATTTCTTTCACCAAATGTTT TGCTAAACACATGTAAATCTAGAGTTTTGATAAGGTTGGC CCACTTCATTTTGTCACAATATTATTGGACTAAGTGTGGG AGGTGGGCCAAGCTCTTGGTCTTTATATGTATGTATATGC TACTTGT
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (ac)21
PCR product (bp) 287
fwd primer emk04D19/U
fwd primer seq. cgcaaaagtcacaatccttcaatg
rev primer emk04D19/L
rev primer seq. atgaagtgggccaaccttatcaaa
fluor. primer emk04D19/U_FAM
dye FAM
fluor. Primer seq. FAM-agcaaaagtcacaatccttcaatg
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 288 288
EPL-1 286 286
LS1151 (S.linneanum) 275 275
LS1934 284 284
LS4021 (S. incanum) 283 283
Nakate Shinkuro 284 284
Senryo 2 284 284
Shironasu 284 284
WCGR112-8 286 286
White Egg 286 286

Population Linkage Group Position
AL2010 E_05 51.6
ALF2 AL05 50.4
LW2010 E_05 45.0
LWA2010 LWA_05 44.637
LWAE2012 E_05 45.821
NAF2 NA05.1 15.3

DB Program Definition E-Value

EST Name Species Strain