+Marker Data: emi02K11

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 53.9
Annotation
Source Name emi02K11
Source Type genomic
Source Sequence CTAATGTAATTTCATATTGTCTCTCCTATACTGTTTACTT TAGCCTGTTTTACATACAGTACACTTCACGTACTAATGCC CCTTTGGTAGCCTGTTTTACATACAGTACACTTCACGTAC TAATGCCCCTTTGGTGCTGTATCATTTTATGATGCAGATT CAGTAGACAGAGCACTTCAACAGGCAAATCGTTGAGGTTA AGAGATTTCCTGATTTCCAGATAGTGGTGAGTCCTTCCCT GCATTCAAGGATGTTTTCTTATTTTCAGATGTTCACGTTA TTTCTTTTGAGTTGTGGTAGCCACGACCTGTCATGGTACC TTCTTAGACAGTAGTTATAGAGGCTTCATAGGCACAAATA GATGATGGGACTCTTTCCCCTTTCTCTATTTTTAAACTGT GTCCTTTTGTTAATCTTGTTCCATGTAATAGATAGAATTG ATGAGTCTTGTAGCCCACTGATAACTTAGATTATTCTTTA ATATCTTCTGCTAATCAACTGATTGAATGAATGTGATGAG ACTAGGTGGTTCACTTGGGGGCTAGCAATAGTCTTCGAGT GCCAATTATGCCTAGGGTACCCTCTCGGGGCATTACATAC TCTTTTCGAAATGAGACAATACCTTCTTAAGATTTTCTGG CTCTCTATCATCACTAGTGGGAACATACTTTAAAAAAAGG TATTTAAATAACTCTATCGTTATCTTTTCTAATCTCTACA GAGGTTGATAAAGCCTGTTAGAGCCCATCTATACACACAT ACATACACACACACACACACACACACACATATATATTACA CTCACAACTATAGAGTACATGGCCAACGTTTGAAATATAA TAGACATTCATCAAAACAGAAGGTGAGTGCTGAATGTCCA TAG
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (ac)3atacat(ac)12a(ta)3
PCR product (bp) 299
fwd primer emi02K11/U
fwd primer seq. gggggctagcaatagtcttcgagt
rev primer emi02K11/L
rev primer seq. tttcaaacgttggccatgtactct
fluor. primer emi02K11/U_VIC
dye VIC
fluor. Primer seq. VIC-aggggctagcaatagtcttcgagt
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 299 299
EPL-1 299 299
LS1151 (S.linneanum) 291 291
LS1934 297 297
LS4021 (S. incanum) 313 313
Nakate Shinkuro 297 297
Senryo 2 297 297
Shironasu 297 297
WCGR112-8 297 297
White Egg 297 297

Population Linkage Group Position
AL2010 E_05 53.9
ALF2 AL05 53.4
EW2009 LG14 13.3
LWA2010 LWA_05 46.072
LWAE2012 E_05 48.736
NAF2 NA05.1 16.5

DB Program Definition E-Value

EST Name Species Strain