+Marker Data: emh11F10

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 52.2
Annotation
Source Name emh11F10
Source Type genomic
Source Sequence ACAAAGCTCCTTCCAAAGGAACATTGCTTTGAAACTTCAT TTTCCTTCTATAATCTTCTTCCCTCCATTTCTCATTCACA CCAACTTAGCTAGCTTTAATCAATAACTAGCTTTAACAAT AACTCTCTAAATAAAACCCTTAAAAATGTTTATACTATGT TTTCTTTTGTGATTTGGAAGCTACTCTCTCTCTCTCTCTC TCACTCTCTCTCTCTCTCTCTCTTTCTAATTCCTAGTTTT TTTACTCTCTTTCTCGTATCTCTTTTTGATGTCCCTTGAT CGATTCTCAATAGCCTTCATTTATAGCAGAAATTTAAGTT TTAAAATCCATATTTGAAACCCCAAAAATAAGTGAGAACC TTTGTACCTTAATTGCCATGCTCAGGAGGTGGCAGGCCTG TGAAACCTTATTGGGGGTTTGT
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (tc)9ac(tc)9tttctaattcctagttttttta(ct)3
PCR product (bp) 232
fwd primer emh11F10/U
fwd primer seq. ttccctccatttctcattcacacc
rev primer emh11F10/L
rev primer seq. ttgagaatcgatcaagggacatca
fluor. primer emh11F10/U_PET
dye PET
fluor. Primer seq. PET-atccctccatttctcattcacacc
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 238 238
EPL-1 236 236
LS1151 (S.linneanum) 236 236
LS1934 236 236
LS4021 (S. incanum) 232 232
Nakate Shinkuro 236 236
Senryo 2 236 236
Shironasu 236 236
WCGR112-8 236 236
White Egg 236 236

Population Linkage Group Position
AL2010 E_05 52.2
ALF2 AL05 50.8
LWA2010 LWA_05 45.019
LWAE2012 E_05 46.779
NAF2 NA05.1 15.3

DB Program Definition E-Value

EST Name Species Strain