+Marker Data: emh05H12

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 42.0
Annotation
Source Name emh05H12
Source Type genomic
Source Sequence NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGCCTTGCTAG CAGAAGCCTTGTGAACAGTCCGTATTTGTTTCTTGGCATT CTTATGATAATTTGTCAAAATTTTAATTCCTATGTTTGGA AAATTTATAAGTTCCAATAATATGTAAACGTTTGCTAGAT TTTATAAGAACTTATGTTGCAATATTTTTGGAAAACTATA AAGGTCCATAACTAAAGTAAAGAGCTGAGACTATCAAAGA TGTAATTTGTGGTGAAAAGATTGGCAAGGTTTTGAGGAGG TAGGTGAATAGTCTTGGTGAAAATATAAGATTGCTTAGAG AGTAAGAGATGGATGGAGTAGTTGAGGTGATAAAAACAGT TTTGTGAGAAGAATAAGTCCAAAAATGCCTTAATATGATG CATTCAAGATAGAATAAAGTGGATCAGCAGTAAGAGATGG ATGGAGTAGTTGAGGTGATAAAAACAGTTTTGTGAGAAGA ATAAGTCCAAAATGCCTTAATATGATGCATTCAAGATAGA ATAAAGTGGGATCNNNNNAATGCCCATTTTCTTTTACAAA AACAAAAACCAAGCAGAAAATAGTGAAGAAAAGGTCACTG CTCTTAGTTTCTGCAACTTTCTTGTAGCAGTGACCAAGTA GATCTAGCCATACTTTGAAAGTTCTATCTCTCTCTCTCTC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TGTGTGTGTGTGTGTGTGTGTGTAATGAAGAAAGGATCGC TGCTCTGTAACAGTGACGAAATAAATCTAGCCATAATTTG AAGGTTTTATGTTTCTCTCCGTGTGTGTGTAATGATCAGT TCCATCCACATTTGGAACATAGAGATTAAGCAATTACATG TTTCCTTGTTTCTTCATTGGTTACAAGAACCCTTCAGTAT TTGCCCAAAAGAGGAAGCATTACTGCAATTTATGCATGCT TAAAGNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (tc)27(tg)11
PCR product (bp) 175
fwd primer emh05H12/U
fwd primer seq. ggtcactgctcttagtttctgcaa
rev primer emh05H12/L
rev primer seq. cagagcagcgatcctttcttcatt
fluor. primer emh05H12/U_PET
dye PET
fluor. Primer seq. PET-agtcactgctcttagtttctgcaa
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 203 203
EPL-1 188 188
LS1151 (S.linneanum) 153 153
LS1934 149 149
LS4021 (S. incanum) 186 186
Nakate Shinkuro 188 188
Senryo 2 188 188
Shironasu 149 149
WCGR112-8 202 202
White Egg 202 202

Population Linkage Group Position
AL2010 E_05 42.0
ALF2 AL05 72.3
EW2009 LG14 0.0
LWA2010 LWA_05 55.388
LWAE2012 E_05 37.975
NAF2 NA05.1 6.5

DB Program Definition E-Value

EST Name Species Strain