+Marker Data: emg21I10

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 51.5
Annotation
Source Name emg21I10
Source Type genomic
Source Sequence TATTCAATTGCTTCTATTGCTCAGTTTAGACCAAATGAAG TCATTGCACAAAACAGTTGCACTTGCGTTAACTATCCTTG TTTCTTGCAGGGACTTGAAGTCAGGCAGTACAATCTACTA GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA AAGAGAGAGAGAATCCCTCCTCCATATATAATCAATTGTT TTACTTGTTTTAGATATCATTTTCTGGATGTTCTTATCTA GAAGAAACCACTAGCAAAACCAAAGAGACCAAGGTAACAT GAAGGAAAATTACAGCTACATCATACGAATACTGATAATA TTCTTCCATTAAGTTATAAAATATTCAGTAAATTGAAAGC CCAAAGTGACGTACTCTGCCCCAATTTACCTTAAAGACAT TGATTTATAGTCACATAAATATCTATAGATTGTTTCTACC ACAAGTTTCAAATGTCTTCCAAACATTGTTTAACACCATG CCCAGTCAGACGCCGTGCCATAAATTGGGACAGAGGGAGT ATGTTTAACTAGGATGAAGA
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (ag)20aa(ag)5aatccctcctcca(ta)3
PCR product (bp) 198
fwd primer emg21I10/U
fwd primer seq. atccttgtttcttgcagggacttg
rev primer emg21I10/L
rev primer seq. tggtctctttggttttgctagtgg
fluor. primer emg21I10/U_NED
dye NED
fluor. Primer seq. NED-atccttgtttcttgcagggacttg
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 204 204
EPL-1 206 206
LS1151 (S.linneanum) 221 221
LS1934 206 206
LS4021 (S. incanum) 210 210
Nakate Shinkuro 206 206
Senryo 2 206 206
Shironasu 206 206
WCGR112-8 202 202
White Egg 204 204

Population Linkage Group Position
AL2010 E_05 51.5
ALF2 AL05 50.0
EW2009 LG14 7.4
LW2010 E_05 44.0
LWA2010 LWA_05 44.199
LWAE2012 E_05 45.113
NAF2 NA05.1 13.6

DB Program Definition E-Value

EST Name Species Strain