+Marker Data: emg11K11

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 52.7
Annotation
Source Name emg11K11
Source Type genomic
Source Sequence CCTCCCTTATTCCTCATTTTAAAGCTTTTTCGAGTGCTTT GTTTTCCTCTTTTCAGTTGTGTCTCATGTTCGAACTCAAT TTGCTATTCTTTTCAATTTAAGGCAACTTTTCTTTCTTTT TTCTCTCACCCAACACATAATTTCCTCTTCTTCCTTTCTT TCCCCACTAATCACCTCATTTTCATTACTTTACCACAACA TAGGCCTGGTTCGAGTGACATTGGTAATTTGGGCTATGCT TCTTTAACTGTCTGGAACATGAGGACTTGGAAAGCTATGG TATGTGATTATATTGGGTCCCATTGTATCCAAGTACTCAA TTTACAAGAACATTTCTTTTCCTTTCTGCATGAGGATTCT CAAACCTAACTCTCTTCAAACTTTATTGAAGACAGTCCTT CCTCTTGGTGAAGATCCACCTCCAATTACTTCAGTATGCT TCAATCACAATGGAAAACTTTTAGCAGCTGCAGCTTCTGA TGGAATGATACACATGTTTGGTATCCTTGTCTGAACTAGT GAACACAGTCTGTAGCCGTCCTCTCTTGTACCTTGCATTA GAAACTTTTACATTTTTTCCCGTATTCTATGTCTATTTTT TTTATACGAAGGTTTCCCAGAAACAGCCTCTCTACCTCTA TGAGGTAGTGGTAAGGTCTGCATACATTTTATCCTCCCCA GACCCCACTTGTGGGATTCCACTGGGTATGTTGTTATTGT TGTATTCTATGTCTATTTCTCTCTCTCTCTCTCTCTCTCT CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTTGGTTGT GAGTAATGGGATTTCAGAGTGAATCTGTGCAGTTAGGAGA TGCTCTCATAACTTTGCTGG
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (tc)27
PCR product (bp) 299
fwd primer emg11K11/U
fwd primer seq. tagccgtcctctcttgtaccttgc
rev primer emg11K11/L
rev primer seq. tgcacagattcactctgaaatccc
fluor. primer emg11K11/U_VIC
dye VIC
fluor. Primer seq. VIC-atgccgtcctctcttgtaccttgc
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 304 304
EPL-1 301 301
LS1151 (S.linneanum) 291 291
LS1934 301 301
LS4021 (S. incanum) 292 292
Nakate Shinkuro 301 301
Senryo 2 301 301
Shironasu 295 295
WCGR112-8 301 301
White Egg 301 301

Population Linkage Group Position
AL2010 E_05 52.7
ALF2 AL05 51.5
LWA2010 LWA_05 45.398
LWAE2012 E_05 47.172
NAF2 NA05.1 15.9

DB Program Definition E-Value

EST Name Species Strain