+Marker Data: eme30D06

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 53.0
Annotation
Source Name eme30D06
Source Type genomic
Source Sequence AACAACAATGCCGAGTGCTTTACACCTCGAAAGGTCAAAT CGATTGAAACTAAAACAGTGATAACTCATATTGAAGCATA TTACAACAATCGAAAGAGAACGAGTACAAGAAAAACATCG CAAATTGAAAGAAACTAAAACAGAACTTATTGAAAACATA CCTCGAAGAATGATTGTTCAGAGAAACTTTGAAAGATTTT GCAGAACAGAGAAAGCGGCGCTAGGGTTTCCTTCATCCTC TTGCAGAACAGAGAAACGCTGAAGCGAAAGTGGCGCTAAG GTTTTGGTATGGTGAATTATGAGGTGGAAGAGTTTATTAA AAAAAAAATTCAGTCCACAAAGATGCAAGTATAGTATATT TGGTCCCTAAACTTTTGGGTGTGTATATATATATATATAT GTGTGTGTGTGTGTGTGTGTATATATATGTGTATATATGT ATATAAATGTGTATATATATGTATATATGTGTGTATATAT ATGTATATATGTGTGTATATATAATGTCGGATTGGTTTGG TTCGGGTTGGTTTTTTTAAAATTTAAACCAAACCAACCCA AATATAGTCGGGTTTTTTTCGTCAACACCAAACCAAACCA AACCATTAGTCGGGTTTTTTTGTCGGGTTGGTTCGGTTTG CGGTTTGGTTCGGATTTCGGTTTGGTTTTGCTCACCCCTA GCAGTTACACATGGAATTGTAAAAAAGC
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (gt)3a(ta)7(tg)10(ta)4tgtg(ta)3tg(ta)3aatgtg(ta)4tg(ta)3(tg)3(ta)4tg(ta)3(tg)3(ta)4
PCR product (bp) 299
fwd primer eme30D06/U
fwd primer seq. gcgctaaggttttggtatggtgaa
rev primer eme30D06/L
rev primer seq. ccgactatatttgggttggtttgg
fluor. primer eme30D06/U_NED
dye NED
fluor. Primer seq. NED-acgctaaggttttggtatggtgaa
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 305 305
EPL-1 308 308
LS1151 (S.linneanum) 304 304
LS1934 307 307
LS4021 (S. incanum) 308 308
Nakate Shinkuro 307 307
Senryo 2 307 307
Shironasu 307 307
WCGR112-8 305 305
White Egg 305 305

Population Linkage Group Position
AL2010 E_05 53.0
LWA2010 LWA_05 45.577
LWAE2012 E_05 47.475

DB Program Definition E-Value

EST Name Species Strain