+Marker Data: eme03F04

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 100.0
Annotation
Source Name eme03F04
Source Type genomic
Source Sequence CCTGACTTTATAAGTTTGGTTTCCCATGCAGATTATGTGA TCTTGTTGGTTTTGGTGTTGCAATTGCCACTGGTGGGCAA TTTGTGATGAATTTCCCAGAGAGAACTTACAAATCAATGT TGATACCACTAATGCAAGAAGATAAAAGATCTGGTATGAT TCCTATAATTATGCAATGCCAGTCAGATTATTTAGTGAAA AATGCAAAATATGAAACATTTGTGAATGAACATTTGATAC ATTTCCTGTAGGTGAAACTACTCGGAGAGGGTTTTATGTG TATGACGACAGACGTAAAGCGACCCCAGATCCAGAAATAA AGAAATATATTGAGAAGGCAAGAGAGATGTCTGGTGTTAC CATCGACCCCAAGGTCTCTCTCTCTCTCTCTCTCTCTCTC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCCCT TGTGGTTGACGAATACTACTCTTGGGATTCTTTTCAGAAA TTCTACCCTGCTCTTACTCAATTGTTTTGAACTCGACACA GATGGCAAAACTCTGGGACCATGAT
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (tc)31
PCR product (bp)
fwd primer eme03F04/U
fwd primer seq. tatgacgacagacgtaaagcgacc
rev primer eme03F04/L
rev primer seq. cagagttttgccatctgtgtcgag
fluor. primer eme03F04/U_PET
dye PET
fluor. Primer seq. PET-ATATGACGACAGACGTAAAGCGACC
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 260 260
EPL-1
LS1151 (S.linneanum) 215 215
LS1934 256 256
LS4021 (S. incanum) 215 215
Nakate Shinkuro 258 258
Senryo 2 259 259
Shironasu 257 257
WCGR112-8 260 260
White Egg 261 261

Population Linkage Group Position
AL2010 E_05 100.0
EW2009 LG12 0.0
LW2010 E_05 100.6
LWA2010 LWA_05 97.51
LWAE2012 E_05 97.044

DB Program Definition E-Value

EST Name Species Strain