+Marker Data: ecm040

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 53.9
Annotation
Source Name OVL01O15W
Source Type EST
Source Sequence GGGGGAACCCTACTAAATCTGTTTGATTTTCCTCAAATTT CAAACTTTTTAAGGCAATTTCAAGAACAAGATTCCTTTTT TGAGGGTTATGAGTCATCCAGTCGCCAGAAGCTTCCTGTT CACGACACTTCTTATTCAAGGCATGTCGTCAATCAGTATG TGGAGGAGGTGGAGGATGATGACAACGAAGAAGAAGAAGA AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGATGAT GATGATGATGACGATGGCGATGAAAATGGTGTTCAGCGGA TAGGGAAAGATGTGTTTGAGGATGAGGATGATGATGATGA GTATGGTGATTCGCAGAGACATCAAAAGAAGAGGAAGTTA AAGAGCTTGTTATCAAGTTATGAGTTAGCACCTCGAGTAC CACCACCATCTACTACAGCTGCAACTGCTCCCAAGCCTAC ATTTGGTGGTAGGAATCCACTTTCTGACTGNNNNNCCATT CCTTTCATGTTGGGTATTTTTCATTGTTGTATTATAACTT GCATGTTAGTTTTTCCCTGGGGATGGCAATATACAAGACA ACTAAATGTGATGTAAGAATGTTTTTGAATGTAGTTTCAG CAGGCAATAATAACATAATGGGGAACCCAATTTCAGGAAA AAAAAAAAAAAAAAAAAAAAAAAAAGTAG
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (gaa)16(gat)5
PCR product (bp) 277
fwd primer ecm040/U
fwd primer seq. tatgtggaggaggtggaggatgat
rev primer ecm040/L
rev primer seq. tgggagcagttgcagctgtagtag
fluor. primer ecm040/U_PET
dye PET
fluor. Primer seq. PET-attgtggaggaggtggaggatgat
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 277 277
EPL-1 280 280
LS1151 (S.linneanum) 309 309
LS1934 280 280
LS4021 (S. incanum) 297 297
Nakate Shinkuro 286 286
Senryo 2 280 286
Shironasu 280 280
WCGR112-8 280 280
White Egg 283 283

Population Linkage Group Position
AL2010 E_05 53.9
LWA2010 LWA_05 46.327
LWAE2012 E_05 48.363

DB Program Definition E-Value

EST Name Species Strain