| Crop | pepper |
|---|---|
| Population | KL-DH |
| Linkage Group | KL10 |
| Marker Type | SSR |
| Map Position | 114.99 |
| Annotation | |
| Source Name | |
| Source Type | |
| Source Sequence | |
| Developer | Seoul National Univ |
| Document | Lee et al. (2004) Characterization and molecular genetic mapping of microsatellite loci in pepper. Theor. Appl. Genet. 108: 619-627 |
| old source name | |
|---|---|
| typing_method | 13% PAGE |
| motif | |
| PCR product (bp) | |
| fwd primer | |
| fwd primer seq | tttttcaattgatgcatgaccgata |
| rev primer | |
| rev primer seq | catgtcattttgtcattgatttgg |
| PCR condition | 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C |
| polymerase | Native Taq |
| comments |
| Line | allele-1 | allele-2 |
|---|---|---|
| K9-11 | 278.6 | 278.6 |
| MZC-180 (selfed LS2341) | 284.5 | 284.5 |
| Population | Linkage Group | Position |
|---|---|---|
| KL-DH | KL10 | 114.99 |
| DB | Program | Definition | E-Value |
|---|
| EST Name | Species | Strain |
|---|

