Crop | pepper |
---|---|
Population | KL-DH |
Linkage Group | KL01 |
Marker Type | SSR |
Map Position | 0.0 |
Annotation | |
Source Name | |
Source Type | |
Source Sequence | |
Developer | Seoul National Univ |
Document | Lee et al. (2004) Characterization and molecular genetic mapping of microsatellite loci in pepper. Theor. Appl. Genet. 108: 619-627 |
old source name | |
---|---|
typing_method | 13% PAGE |
motif | |
PCR product (bp) | |
fwd primer | |
fwd primer seq | aaccagcaatcccatgaaaacc |
rev primer | |
rev primer seq | gggctttggggagaatagtgtg |
PCR condition | 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C |
polymerase | Native Taq |
comments |
Line | allele-1 | allele-2 |
---|---|---|
K9-11 | 136.8 | 136.8 |
MZC-180 (selfed LS2341) | 152.6 | 152.6 |
Population | Linkage Group | Position |
---|---|---|
KL-DH | KL01 | 0.0 |
DB | Program | Definition | E-Value |
---|
EST Name | Species | Strain |
---|