| Crop | Chinese_cabbage |
|---|---|
| Population | AGF2 |
| Linkage Group | 8_R2 |
| Marker Type | SSR |
| Map Position | 60.8 |
| Annotation | |
| Source Name | |
| Source Type | genomic |
| Source Sequence | |
| Developer | NIVTS |
| Document | Suwabe et al (2006) Simple sequence repeat-based comparative genomics between Brassica rapa and Arabidopsis thaliana: The genetic origen of clubroot resistance.Genetics.(173) 309-319 |
| motif | (CT)26 |
|---|---|
| PCR product bp | 123 |
| fwd primer | BRMS-026F |
| fwd primer seq. | CCTATCCTCGGACTAATCAG |
| rev primer | BRMS-026R |
| rev primer seq. | CTTGATGAGTTTCACATTGC |
| dye | PET |
| PCR condition | 94C_3min->(94C_30s->55C_30s->72C_30s)x30->75C_7min->10C |
| polymerase | rTaq(Takara) |
| Line | allele-1 | allele-2 |
|---|---|---|
| A9709 | 123 | 123 |
| G004 | 128 | 128 |
| Kigokoro85 | 146 | 180 |
| Kigokoro90 | ||
| Muso | 133 | 146 |
| Population | Linkage Group | Position |
|---|---|---|
| AGF2 | 8_R2 | 60.8 |
| KHF2 | 8_R2 | 15.3 |
| DB | Program | Definition | E-Value |
|---|
| EST Name | Species | Strain |
|---|

