+Marker Data: SOL8566

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SNP
Map Position 102.7
Annotation
Source Name PED06G17F
Source Type 16k_SmUnigene
Source Sequence
Developer NIVTS
Document

Typing_Method Tm-Shift
Marker_Class SOL
STS_primer_fwd tttccccagagagtggcataccta
STS_primer_rev gctcctttgcaaaatcctcatctc
amplicon_seq NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGTGTTCAGGATTTGAATTAGATTCAACCAAGTACTAGCTGTTGCGACGATTCCTGTTACAGTTTCTGAATGTATCCACTAATGATATTTGCTTGCAGGAAGATTCTCCAAAAATCAGGTAAGGACTATACCATTCTCTTGGTCCTTCCGTCGGGTATATATCATTACAAATTCATTGTGGATGAAGAAGTTAGATATATTCCAGAACTTCCATGTGTAGCAGATGAGACAGGCATCGTCTTTAATCTTCTTGATGTTAATGTAAGTGAGATTTCTGCCTCCTGATTANTGAGAGGAAGCTGATTTACATTTGCCTAATGAACTCNTAGTTACATTATCACAGCAGAGGCATCTCTGATAATGTTAGCACCTTAATGCATAAACATATGTTCTATATTCTATATAATACCTGCTATTCCCTGAGAATTTGTTTGGCTCATAACATAACTTACGNCTTTCCGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
SNP_position 124
allele_1 C
allele_2 G
ASP_primer_S GCGGGCACTAGCTGTTGCGACGATTCCTGTTAG
ASP_primer_L GCGGGCAGGGCGGCACTAGCTGTTGCGACGATTCCTGTTAC
Common_primer TTCCTGCAAGCAAATATCATTAGTGGA
enzyme Stoffel frag.
dye EvaGreen

Line allele-1 allele-2
AE-P03 C C
LS1934 G G
Nakate Shinkuro G G
WCGR112-8 C C

Population Linkage Group Position
AL2010 E_05 102.7
ALF2 AL05 133.2
LW2010 E_05 102.9
LWA2010 LWA_05 100.113
LWAE2012 E_05 98.953
NAF2 NA05.2 6.9

DB Program Definition E-Value

EST Name Species Strain