+Marker Data: SOL8264

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type indel
Map Position 90.1
Annotation
Source Name RBW05K21R
Source Type 16k_SmUnigene
Source Sequence
Developer NIVTS
Document

Typing_Method indel
Marker_Class SOL
STS_primer_fwd gggacaaagggaaattgttggtta
STS_primer_rev cgtctcgaaatcctttcctctcaa
amplicon_seq NNNNNNGTATTTGACAAAGAATGTACCTCGATGATGCACCTTNTGGGTCTTACTGTGTTTGATAAACAAGTTGTTTTGTATAGAGATGGAAGTGGTGAACTTAGATGCTTTGAAGATAGATGTCCACATAGGTAAAACATATATGTTTTTGTCATATATTTAAGTTTCTGCTTTTTGGGGCTTGATTTCGGAAACAACCTCTCTTCTCTCTGTGAGCTAGTGGTAATGTCTGCATATATTTTACGCTCTCCAGACCTGGATTCCAATGGGTATGTTGTTATTGTTGCTTTGATACATGCACTTAAGTTTCAATTGTGTTTTCACTGTCGCTGTCGCAGTCCAGTGCACAAAGCATCCCATATTACATATCCAAATATAAGTAGTATAAGTGATTGCTTTAACGACTCAAACCTATTAGGTCACGCGGAGATAACTTTGCTTTTCTAGAATTTAGCATTTTAGCATGATCTTGCTATGCATAAACTTTTTTTTTACTTGTCCCTTGTTAACTTGACAATCCCTATGCCCCTAAGAGAAGTATTTATTAGGTTTTGTTAAACTATATTATCCTTATTACCCGGTGCACTAAGCTCCCGCTATGCGCAGGGTTCGGGAAGGGCCCGACTACAAGGGTCTATAGTACGCAGCCTTATCTTATATTTCTGCCATCTCTTGATTTGCTAAATGGACAAGTGAAAGTAAAATCTATTTTTGGTACAAGGGACAAGTAAAAATGGAAAGTAGGAAGAAAGCATTTGTAGCAACCATGACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTACTGTTCTGCCTATTTACATCAACCGGTTAACTGTTGCCTTAAATCTGTTTTTAGTGTGGGAAGAAATCCACATTTAGTGCAGATTTACCATCTTCCACTCTCTCCGGCATGTGTCTTTTGTCTGTCTATTCTTTTTCTTTTTCTTTTACTTTGATGGAGCGACAAACAGTTGAATCTCAGTGGTTCGTGACAATAAAACCACTCTGCCACTTACAATGCTCCATACTGTCTATCCATTAGTTAAAAGTTCAACTAAACTGACTTCCACATTGTCGCAAGACCACCTCTTTTGACTTTGCATCTAATCGTGACATTACCTTATGTGTTCAGATTAGCCAAACTCTCTGAAGGACAACTCTACGATGGCAAACTGGAATGCTTGTATCATGGTTGGCAGTTCGACGGAGATGGAAAATGTGTGAAGATACCACAGGTTGATTTTATATATGCATCTTTGTTTATGTTTCATGTGAATGTTATACACCATTTTCATTCTCGTCTTTGATTTTGTTCCTGTCAGTTACCTGAAAATGCTAAAATTCCTCGATCAGCTTGTACCAAGACATATGAAATTCGGGATTCCCAGGGAGTAGTCTGGATATGGATGTCTCACAGAACACCACCTAATATNN
indel__position 331
Indel_primer_fwd TACGCTCTCCAGACCTGGATTC
Indel_primer_rev AGCAAAGTTATCTCCGCGTGAC

Line allele-1 allele-2
AE-P03 wt wt
LS1934 INS6 INS6
Nakate Shinkuro wt wt
WCGR112-8 wt wt

Population Linkage Group Position
AL2010 E_05 90.1
LW2010 E_05 90.9
LWA2010 LWA_05 88.008
LWAE2012 E_05 86.798

DB Program Definition E-Value

EST Name Species Strain