+Marker Data: AF244121

Crop pepper
Population KL-DH
Linkage Group KL03
Marker Type SSR
Map Position 21.63
Annotation
Source Name
Source Type
Source Sequence
Developer Seoul National Univ
Document Lee et al. (2004) Characterization and molecular genetic mapping of microsatellite loci in pepper. Theor. Appl. Genet. 108: 619-627

old source name
typing_method 13% PAGE
motif
PCR product (bp)
fwd primer
fwd primer seq tacctcctcgccaatccttctg
rev primer
rev primer seq ttgaaagttctttccatgacaacc
PCR condition 95C_1min->(94_30s->55C_30s->72C_1min)x35->72_5min->4C
polymerase Native Taq
comments QV: estimated by sequencer

Line allele-1 allele-2
K9-11 235.5 235.5
MZC-180 (selfed LS2341) 234.4 234.4

Population Linkage Group Position
KL-DH KL03 21.63

DB Program Definition E-Value

EST Name Species Strain