+Marker Data: emi02E15

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 78.1
Annotation
Source Name emi02E15
Source Type genomic
Source Sequence CTTTGACAGACACAGTTTTATAGATGGATGCAACTATATA ACTACGAATTTATCTAAACCTAATACATTTAAACGATAGA TAAATTTAGTTGTAAAAACTCATTGAATTACAAGAAATAG TATGTCTAAACTCATAATATTAAAAATAAAATAGATTCAA TACTACAAAATTTGAAAAATTGAAACCATAAAAACTTAAA TCATGGAGCCACCTTTGATTTTACCTAATTTTATGACGGT GGAAAAGGAGTTGGTACCATCTGAAATTAATCGAAGTTTC AAATATCTCTCTCCCCCTCTCTCTCTCACACACACAAAAC TTAAATCATGGAGCCATCTTTGATTTTATCCTAATTCTAT GACTACAGAAAAGTAGTTGGTACGATTTGAAATTAATCGA AGTTCCAATCACTCACTCACACACACAAAAAACTTAAATC ATGGAGCCACCTTTGATTTTACCCTAATGTCGAAGTTTCA ATCACGTATACACACACAAAACTTAAATCATCAAGCCGCC TTTAATTTTATCCTAATTTTATGACGATGAAAAAAGTAAT TGGTACCATCTGAAATTAATCGAAGTTCCAATCACACACA ATATGTAAACAAACCTATATATTGTAGAGCTTCTTATCGC TGTAGTTGAACAAGAACACTGGCAAACCAGGATTTACATT TTTCACATATGAAATGTGTTGGCCAGGCAAACCTGTCAAA AAATTTTAAATGTATATAATTGAGTAACAACAACCCATCA TCCTGATTTCTTTTTATTGAAGGACAATATATTAGGGCCG AACAACTGACCTACTAGTTGCTTCTCGAGACACTCTCTGA TTGTAGCATTTGTGCAGCCAAATATAACACCGCCTAGTTG ATCTCTTGGCAGATTTCTAAAAGTTCGAGCATATCTTGCC TGGAATGGTGATGCTGGTGCTGAATTACTATGTGTGAACG TGTATGTTCTTTTCTTTTCCCACATCCTGAAAAAAAATCC ATATGGACAAAACGAAATCATCATGAATTGTAAAAGAAAA ACAGAACTAAAGAGCCATAAAAGAACTAAACTGAACTATA AGCAAG
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (tc)4cccc(tc)5(ac)4
PCR product (bp) 289
fwd primer emi02E15/U
fwd primer seq. tatgacggtggaaaaggagttggt
rev primer emi02E15/L
rev primer seq. ggcggcttgatgatttaagttttg
fluor. primer emi02E15/U_NED
dye NED
fluor. Primer seq. NED-attgacggtggaaaaggagttggt
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 290 290
EPL-1 290 290
LS1151 (S.linneanum) 290 290
LS1934 289 289
LS4021 (S. incanum) 290 290
Nakate Shinkuro 290 290
Senryo 2 290 290
Shironasu 289 289
WCGR112-8 289 289
White Egg 289 289

Population Linkage Group Position
AL2010 E_05 78.1
ALF2 AL05 108.9
EW2009 LG12 16.7
LWA2010 LWA_05 75.743
LWAE2012 E_05 72.01

DB Program Definition E-Value

EST Name Species Strain