+Marker Data: emh21P02

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 0.0
Annotation
Source Name emh21P02
Source Type genomic
Source Sequence ACAACCACTTGTCTATACAGGCTGCGTGAAAATGGTGACG ACAAGGGAGCTCACGGAGTTCAATTCCATCTTCATAGGAA CAAAGGCAAATGCAACATTCCTGCAGACGTAAAGATAGAA TGTAACTTCTAGGACTCGGAAAGTTAGAGATATACTTTAT GAAAACTTCTTGGCTGAGAAAAGACATGTTTCACAAAACA TACAGCATCTTCTGGGGAAAGAGCATGCTCAGTAGGCGTA TCGGTGTCACATTCAACCATTACTCCTCCAAATGATTCTT GAATCTCACCATTCTCTTTCTCAAAGTTGCCTAGTCTCTT GAACTTGTATTTAGGCAGTCTTTCAACATCTTCCTTAGTT GCACCTTCCTGTTTCAAAGGATAAGTAAATTATGAGAGAG AGAGACAGAGAGAGACAGAGACAGAGAGAGAGAGAGACAG AGAGAGAGAGATGATCTGAGTAAGAAAAGCATTCGACAAG ATTTTCAAGTTGATAAGATTGGTCGAGTGGTCTCAATGGG AGATGAAAACGCGTGTTTGTGGATTGAAAGAGATTCAAGT TGGGGGATCAATGTGAGGACATCAATTCAAATCCTTGGGG ATTCCGGCAAAAGCTGAAATTCCAGTTGCATTTTATTTCA CAAGGGTGCAGAGCCTACTACACCTTTTCTATCACTTCGA TTCGTATTAGAATGCACACAGCATCACCTTTCAATAATAT AGAACGGAGACTGTATTGTCCTATATAAAAGATCTTTTCT TAAAAGAACTTAACAAAAGGCACAAGAAAAATCCCCAACA ACACTGATCTACCATCCTCCGTTTTATGTTTCTAAAATTA ACTCGGATGTATGAAATAAACCAAAAAAATGGATGATCTA ACAAAATTTGCAACAATTCTTTGAACCATATTGAGAAAAA CCAATATATTGTGTAACAAGGAGCTCTAACTCAGACAACA TATTAAAAAGAACAGCTACCTCAAAGCATACATATACACA CGCGCGT
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (ag)5ac(ag)4acagagac(ag)7ac(ag)6
PCR product (bp) 283
fwd primer emh21P02/U
fwd primer seq. cgtatcggtgtcacattcaaccat
rev primer emh21P02/L
rev primer seq. ccattgagaccactcgaccaatct
fluor. primer emh21P02/U_PET
dye PET
fluor. Primer seq. PET-agtatcggtgtcacattcaaccat
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 287 287
EPL-1 285 285
LS1151 (S.linneanum) 280 280
LS1934 285 285
LS4021 (S. incanum) 293 293
Nakate Shinkuro 285 285
Senryo 2 285 285
Shironasu 285 285
WCGR112-8 305 305
White Egg 285 285

Population Linkage Group Position
AL2010 E_05 0.0
ALF2 AL05 0.0
LW2010 E_05 2.0
LWA2010 LWA_05 2.145
LWAE2012 E_05 1.944

DB Program Definition E-Value

EST Name Species Strain