+Marker Data: emf01A06

Crop eggplant
Population AL2010
Linkage Group E_05
Marker Type SSR
Map Position 52.7
Annotation
Source Name emf01A06
Source Type genomic
Source Sequence CTCCTTGTGATAATTGAGATCACCTGGATGTAAGACAAAA AACTAACAGACTTACAAAAATTTCCACATGCCTTCTGACA AGGGTGCGATTGGATTGTGGTAGTAGTCATTTCCAAGCTG AAAATATGAGAAAGGAAGAATGAGGTGAAAAATAACAGTG TTGGTAAGGCAAAAGTGTAGAAATATGCAATGTCAAGAAG GGCCTTTAATCACTACGTTCTTTTAGTCACTATGTTCCTA AAACATCATACGAAAGCCCTTAAGCCTACGTTATAATCCA ATAAAATCCTAAAGTGATCTTAGTCCAAGTTGTCAAAGGT CATAATCATGAGTACAGAGACAAGCATATGGTATTGCACA TGGTTTTTGAATGTCTTTTATGAGAAAGAAAGAGAGAGAG AGAGAGAGAGAGAGATTTTACATTGTCTCAAGCATTGAAA TTGAAAACATCATCATGAGAGGGATATGAGGCTTCTTTCT GAGAGGGCACTTGCATTATATTGGACTAACTCAGTGATTG TTGCTTGTTGATAATTTTCTTGCTTGTCATAGTTGTATTG TCACATATGTTGATCTGTGTTGGTTTACTTGATAG
Developer NIVTS
Document Nunome et al. (2009) Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.). Theor. Appl.Genet. 119: 1143-1153

motif (ag)12
PCR product (bp) 250
fwd primer emf01A06/U
fwd primer seq. acatcatacgaaagcccttaagcc
rev primer emf01A06/L
rev primer seq. aagtgccctctcagaaagaagcct
fluor. primer emf01A06/U_NED
dye NED
fluor. Primer seq. NED-acatcatacgaaagcccttaagcc
PCR condition 94C_3min->(94C_30s->65C_60s,-1C/cyc->72C_60s)x10->(94C_30s->55C_60s->72C_60s)x30->75C_5min->10C
polymerase Roche Taq

Line allele-1 allele-2
AE-P03 254 254
EPL-1 253 253
LS1151 (S.linneanum) 268 268
LS1934 253 253
LS4021 (S. incanum) 254 254
Nakate Shinkuro 252 252
Senryo 2 253 253
Shironasu 253 253
WCGR112-8 255 255
White Egg 255 255

Population Linkage Group Position
AL2010 E_05 52.7
ALF2 AL05 52.3
EW2009 LG14 10.1
LW2010 E_05 46.0
LWA2010 LWA_05 45.41
LWAE2012 E_05 46.762
NAF2 NA05.1 15.9

DB Program Definition E-Value

EST Name Species Strain